An example result looks like this: ********************************* A1: >AT1G01010.1 A2: >AT2G16430 Kmer Ranges: Lower: 74 Upper: 81 Lower: 1243 Upper: 1250 Normalized MiRNA Score: 1.84211 Current Window Size: 19 MiRNA Bounds: 64 83:1241 1260 A1 Region (5' - 3') : AGCGAGAGAGATCGACGGC Quality : ||||||:|||||||||||| A2 Region (3' - 5') : TCGCTCCCTCTAGCTGCTG Precursor Score: 1.36842 Aligned 1: AGCGACTGAGAACGGCGGT Quality : ||||| :||||:||||||| Aligned 2: TCGCTCCCTCTAGCTGCTG PRECURSOR: AGACGCAGTCGTCGATCTCCCTCGCTTCCACGCAGCGTCCGACTCCGTCCAAAGTTCTTGAAGGAGCGACTGAGAACGGCGGTGATGTGG STRUCTURE: ...((((.((((((.((((..(((((((((.(.(((....(((...)))....)))).))..)))))))..)))).))))))...)))). MFE: -29.7999992370605 Precursor Length: 90 Transcript Length: 1486 Comment: 43 ,Changes: 7 where A1: (The name of the targeted transcript) A2: (The name of the intergenic region the precursor originagted) Kmer Ranges: Lower: (Lower transcript index for 7mer) Upper: (Upper transcript index for 7mer) Lower: (Lower intergenic index for 7mer) Upper: (Upper intergenic index for 7mer) Normalized MiRNA Score: (Score of miRNA/Target binding) Current Window Size: (Predicted length of miRNA) MiRNA Bounds: (Bounds of targeted region of the transcript):(Bounds of miRNA in intergenic region) A1 Region (5' - 3') : (Region of targeted transcript) Quality : (Quality of the potential RNA duplex) A2 Region (3' - 5') : (Predicted miRNA) Precursor Score: (Score of the upstream/downstream complement to the miRNA) Aligned 1: (predicted miRNA complement using overlap matches, and not RNAFold) Quality : (Quality of miRNA binding to its complement) Aligned 2: (predicted miRNA) PRECURSOR: (Predicted precursor or miRNA gene) STRUCTURE: (RNA secondary structure predicted by RNAFold) MFE: (Minimum free energy predicted by RNAFold) Precursor Length: (Length of the precursor) Transcript Length: (Length of the transcript in A1) Comment: (Various comments about this hit) Note: ALL indices are base 0 (The first letter is at index 0).